snakevir
Documentation : https://snakevir.readthedocs.io/en/latest/
snakevir [OPTIONS] COMMAND [ARGS]...
Options
- --version
Show the version and exit.
edit_cluster
The command make_config is used for create config fime at yaml format for snakevir. You have 2 choice, you can use arguement for write all information needed in config or you can only use some argument (-o is mandatory) and wirte in the file after the missing information.
snakevir edit_cluster [OPTIONS]
Options
- -p, --partition <partition>
Name of the default partition.
- -a, --account <account>
Name of you’re account for launch job in cluster
- -e, --edit
Edit cluster config for less/more ressources
install_cluster
This function allow to install tools with conda and dowload database needed by snakevir except nt & nr database
snakevir install_cluster [OPTIONS]
Options
- -p, --path <path>
Required Give the installation PATH for conda environment that contains all the necessary tools for snakevir.
- -s, --skip
Skip all install and download if it’s already existing
- -t, --tool
Update conda environment (Re-install conda environment even if it’s already install)
- -d, --database
Update database (Re-download files even if it’s already download)
make_config
The command make_config is used for create config fime at yaml format for snakevir. You have 2 choice, you can use arguement for write all information needed in config or you can only use some argument (-o is mandatory) and wirte in the file after the missing information.
snakevir make_config [OPTIONS]
Options
- -o, --output <output>
Required Path of the output file with ‘.yaml’ extension (config.yml needed for snakevir.
- -d, --output_directory <output_directory>
Path of the output directory for Snakevir’s result.
- -n, --name <name>
Name of run (ex : HNXXXXXX)
- -f, --fastq <fastq>
Path to the fastq directory
- -g, --host_genome <host_genome>
Path to the genome host at fasta format
- --r1 <r1>
Type of your R1 fastq files contains in FASTQ directory (for exemple : ‘_R1’ or ‘_1’, etc. )
- Default:
_1
- --r2 <r2>
Type of your R2 fastq files contains in FASTQ directory (for exemple : ‘_R2’ or ‘_2’, etc. )
- Default:
_2
- --ext <ext>
Etension of your reads files in the FASTQ directory (for exemple : ‘.fastq.gz’ or ‘.fq’, etc.)
- Default:
.fastq.gz
- --path_diamond_nr <path_diamond_nr>
Path to the diamond nr database
- --path_blast_nt <path_blast_nt>
Path to the blast nt database
- --A3 <a3>
Sequence of Adapter in 3’
- Default:
CAGCGGACGCCTATGTGATG
- --A5 <a5>
Sequence of Adapter in 5’
- Default:
CATCACATAGGCGTCCGCTG